Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1201795
End position: 1201818
Length: 24

DNA sequence
>NC_021658, from 1201795 to 1201818 (24 bp); Sorangium cellulosum So0157-2 GCGAGCGCGACCGCGAGCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1201333-1201893	Sequence	SCE1572_04210 - hypothetical protein (Protein is coded in complementary strand; from 1201893 to 1201333)