Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1157195
End position: 1157224
Length: 30

DNA sequence
>NC_021658, from 1157195 to 1157224 (30 bp); Sorangium cellulosum So0157-2 CCCGGCGCCCCCCGACGCTCGCCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1156363-1157424	Sequence	SCE1572_04090 - hypothetical protein (Protein is coded in complementary strand; from 1157424 to 1156363)