Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 1129164
End position: 1129188
Length: 25

DNA sequence
>NC_021658, from 1129164 to 1129188 (25 bp); Sorangium cellulosum So0157-2 CGCCCCGTCCCGCCACGCCACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1129147-1130064	Sequence	SCE1572_03985 - glutaminyl-tRNA synthetase (Protein is coded in complementary strand; from 1130064 to 1129147)