Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 104140
End position: 104163
Length: 24

DNA sequence
>NC_021658, from 104140 to 104163 (24 bp); Sorangium cellulosum So0157-2 GGCGGGGGCCGGGGCGGGGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 103454-105061	Sequence	SCE1572_00335 - hypothetical protein (Protein is coded in complementary strand; from 105061 to 103454)