Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 102274
End position: 102309
Length: 36

DNA sequence
>NC_021658, from 102274 to 102309 (36 bp); Sorangium cellulosum So0157-2 CCGCCGACGCCGCCGCCCGCGCCGCCGTCGCCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 100807-102441	Sequence	SCE1572_00325 - hypothetical protein (Protein is coded in complementary strand; from 102441 to 100807)