Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7646530
End position: 7646553
Length: 24

DNA sequence
>NC_021658, from 7646530 to 7646553 (24 bp); Sorangium cellulosum So0157-2 GAACGGGAGCGGGAGCGGGAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7644279-7646615	Sequence	SCE1572_26670 clpA ATP-dependent Clp protease ATP-binding protein