Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 2274602
End position: 2274664
Length: 63

DNA sequence
>NC_021554, from 2274602 to 2274664 (63 bp); Staphylococcus aureus CA-347 TCCAGCTGGTTGTGTTGTTCCTGCTGCTGGTTGTGTTGTTCCTGCTGCTGGTTGTGTTGTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2267577-2274956	Sequence	CA347_2235 - sasC/Mrp/FmtB intercellular aggregation domain protein (Protein is coded in complementary strand; from 2274956 to 2267577)