Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 1401895
End position: 1401939
Length: 45

DNA sequence
>NC_021554, from 1401895 to 1401939 (45 bp); Staphylococcus aureus CA-347 TTTTTTGTCTTCAGACTTTTTATCATCAGATTTCTTGTCGTCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1401761-1402876	Sequence	CA347_1325 pstS phosphate binding family protein (Protein is coded in complementary strand; from 1402876 to 1401761)