Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 2005864
End position: 2005896
Length: 33

DNA sequence
>NC_021554, from 2005864 to 2005896 (33 bp); Staphylococcus aureus CA-347 ATTTGTTGTTGATTTGTTGTTGATTTGTTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2005357-2006241	Sequence	CA347_1943 - dnaD domain protein (Protein is coded in complementary strand; from 2006241 to 2005357)