Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 1099907
End position: 1099934
Length: 28

DNA sequence
>NC_021554, from 1099907 to 1099934 (28 bp); Staphylococcus aureus CA-347 TTTTTGTTTATTGTTTGTTGTTTATTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1099915-1100844	Sequence	CA347_1035 - glycerophosphoryl diester phosphodiesterase family protein (Protein is coded in complementary strand; from 1100844 to 1099915)