Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 2458778
End position: 2458804
Length: 27

DNA sequence
>NC_021554, from 2458778 to 2458804 (27 bp); Staphylococcus aureus CA-347 ACTTTATCACCTTTATCAAGTTTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2458346-2458993	Sequence	CA347_2432 - hlyD secretion family protein (Protein is coded in complementary strand; from 2458993 to 2458346)