Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 1861338
End position: 1861364
Length: 27

DNA sequence
>NC_021554, from 1861338 to 1861364 (27 bp); Staphylococcus aureus CA-347 CATTCATATCATTCATATCATTCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1856291-1862848	Sequence	CA347_1747 - sasC/Mrp/FmtB intercellular aggregation domain protein (Protein is coded in complementary strand; from 1862848 to 1856291)