Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 1476588
End position: 1476614
Length: 27

DNA sequence
>NC_021554, from 1476588 to 1476614 (27 bp); Staphylococcus aureus CA-347 ATTTTGTGAATTTTGAGAATTTTGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1450939-1476813	Sequence	CA347_1372 ebh extracellular matrix-binding protein ebh (Protein is coded in complementary strand; from 1476813 to 1450939)