Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 1106730
End position: 1106756
Length: 27

DNA sequence
>NC_021554, from 1106730 to 1106756 (27 bp); Staphylococcus aureus CA-347 CTTTAACTTCTTTAACTTCTTTAGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1105103-1107037	Sequence	CA347_1043 isdB heme uptake protein IsdB (Protein is coded in complementary strand; from 1107037 to 1105103)