Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 346430
End position: 346454
Length: 25

DNA sequence
>NC_021554, from 346430 to 346454 (25 bp); Staphylococcus aureus CA-347 AAAGAAATGAAAAAAGAAGATAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 345933-347777	Sequence	CA347_300 - A pre-toxin domain with the TG motif family protein