Sequence retrieval

Genome: Staphylococcus aureus CA-347
Start position: 1766177
End position: 1766201
Length: 25

DNA sequence
>NC_021554, from 1766177 to 1766201 (25 bp); Staphylococcus aureus CA-347 TTCTTTTTTTATCTTTTCTATTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1765329-1766249	Sequence	CA347_1676 dnaI primosomal protein DnaI (Protein is coded in complementary strand; from 1766249 to 1765329)