Sequence retrieval

Genome: Streptococcus agalactiae 09mas018883
Start position: 2006052
End position: 2006111
Length: 60

DNA sequence
>NC_021485, from 2006052 to 2006111 (60 bp); Streptococcus agalactiae 09mas018883 CTCTGGTTTGGCTTCTGGTTTGGCCTCTGGTTTGGCTTCTGGTTTGGCCTCTGGTTTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2005738-2007480	Sequence	BSA_20490 - putative peptidoglycan linked protein (LPXTG motif) (Protein is coded in complementary strand; from 2007480 to 2005738)