Sequence retrieval

Genome: Streptococcus agalactiae 09mas018883
Start position: 1505953
End position: 1505988
Length: 36

DNA sequence
>NC_021485, from 1505953 to 1505988 (36 bp); Streptococcus agalactiae 09mas018883 GTGGAAGCACTGGTTGAAGCACTGGTTGAAGCACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1505041-1508289	Sequence	BSA_15410 - Predicted cell-wall-anchored protein SasA (LPXTG motif) (Protein is coded in complementary strand; from 1508289 to 1505041)