Sequence retrieval

Genome: Streptococcus agalactiae 09mas018883
Start position: 1879165
End position: 1879194
Length: 30

DNA sequence
>NC_021485, from 1879165 to 1879194 (30 bp); Streptococcus agalactiae 09mas018883 AATCCAAAATAATCTAAAAAAATCAAAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1877710-1879614	Sequence	BSA_19160 - Heparinase II/III-like (Protein is coded in complementary strand; from 1879614 to 1877710)