Sequence retrieval

Genome: Streptococcus agalactiae 09mas018883
Start position: 1671499
End position: 1671525
Length: 27

DNA sequence
>NC_021485, from 1671499 to 1671525 (27 bp); Streptococcus agalactiae 09mas018883 ATCTTCTTCATTTTCTTCAGCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1671470-1671874	Sequence	BSA_17120 - Mannose-6-phosphate isomerase (Protein is coded in complementary strand; from 1671874 to 1671470)