Sequence retrieval

Genome: Streptococcus agalactiae 09mas018883
Start position: 37488
End position: 37511
Length: 24

DNA sequence
>NC_021485, from 37488 to 37511 (24 bp); Streptococcus agalactiae 09mas018883 AGTTGAAATTGAAGTAGATGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 36584-40309	Sequence	BSA_580 - Phosphoribosylformylglycinamidine synthase,synthetase subunit / Phosphoribosylformylglycinamidine synthase, glutamine amidotransferase subunit