Sequence retrieval

Genome: Streptococcus agalactiae 09mas018883
Start position: 1063835
End position: 1063858
Length: 24

DNA sequence
>NC_021485, from 1063835 to 1063858 (24 bp); Streptococcus agalactiae 09mas018883 ATTGGTATTGCTTTTGGTCTTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1063142-1067551	Sequence	BSA_11070 - FtsK/SpoIIIE family protein, putative secretion system component EssC/YukA (Protein is coded in complementary strand; from 1067551 to 1063142)