Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 2295072
End position: 2295107
Length: 36

DNA sequence
>NC_021184, from 2295072 to 2295107 (36 bp); Desulfotomaculum gibsoniae DSM 7213 TTACCTTCAGCCCTACCTTCAGCCCTACCTTCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2294898-2295845	Sequence	Desgi_2270 - hypothetical protein (Protein is coded in complementary strand; from 2295845 to 2294898)