Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 3115070
End position: 3115101
Length: 32

DNA sequence
>NC_021184, from 3115070 to 3115101 (32 bp); Desulfotomaculum gibsoniae DSM 7213 TTTTCAACCTTTCAACCTTTCAACCTTTCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3115098-3118316	Sequence	Desgi_3052 - carbamoyl-phosphate synthase, large subunit (Protein is coded in complementary strand; from 3118316 to 3115098)