Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 525167
End position: 525196
Length: 30

DNA sequence
>NC_021184, from 525167 to 525196 (30 bp); Desulfotomaculum gibsoniae DSM 7213 TAAATTACAGTGAATTACAGCGAATTACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 524430-525170	Sequence	Desgi_0545 - CRISPR-associated protein Cas5, subtype I-B/HMARI