Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 4601531
End position: 4601560
Length: 30

DNA sequence
>NC_021184, from 4601531 to 4601560 (30 bp); Desulfotomaculum gibsoniae DSM 7213 GATTCTACTGGATTTTACTCCATTTTACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4601556-4601987	Sequence	Desgi_4522 - Protein of unknown function (DUF1492) (Protein is coded in complementary strand; from 4601987 to 4601556)