Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 2795344
End position: 2795373
Length: 30

DNA sequence
>NC_021184, from 2795344 to 2795373 (30 bp); Desulfotomaculum gibsoniae DSM 7213 TAAACTTGCTTAAACTTTCTTAAACTAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2795374-2796051	Sequence	Desgi_2755 - ribulose-5-phosphate 4-epimerase-like epimerase or aldolase (Protein is coded in complementary strand; from 2796051 to 2795374)