Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 1781775
End position: 1781802
Length: 28

DNA sequence
>NC_021184, from 1781775 to 1781802 (28 bp); Desulfotomaculum gibsoniae DSM 7213 GTCAGTATTCAGTAGACAGTAGTCAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1780675-1781790	Sequence	Desgi_1743 - ATPase component of ABC-type sugar transporter