Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 4801997
End position: 4802023
Length: 27

DNA sequence
>NC_021184, from 4801997 to 4802023 (27 bp); Desulfotomaculum gibsoniae DSM 7213 TCTGTTCCATATGTTCCATATGTTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4800739-4802025	Sequence	Desgi_4711 - lipid A core-O-antigen ligase-like enyme (Protein is coded in complementary strand; from 4802025 to 4800739)