Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 2966330
End position: 2966354
Length: 25

DNA sequence
>NC_021184, from 2966330 to 2966354 (25 bp); Desulfotomaculum gibsoniae DSM 7213 TTTTTTGTTTATTTTTTTATGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2966339-2966593	Sequence	Desgi_2903 - hypothetical protein (Protein is coded in complementary strand; from 2966593 to 2966339)