Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 1497833
End position: 1497857
Length: 25

DNA sequence
>NC_021184, from 1497833 to 1497857 (25 bp); Desulfotomaculum gibsoniae DSM 7213 AAAAAATAAAAAAAGAAAACAAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1496582-1498342	Sequence	Desgi_1482 - adenine specific DNA methylase Mod