Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 1014343
End position: 1014367
Length: 25

DNA sequence
>NC_021184, from 1014343 to 1014367 (25 bp); Desulfotomaculum gibsoniae DSM 7213 TTTTTTTTCTTTTTCTTTTGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1014196-1014468	Sequence	Desgi_0987 - hypothetical protein (Protein is coded in complementary strand; from 1014468 to 1014196)