Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 4508960
End position: 4508983
Length: 24

DNA sequence
>NC_021184, from 4508960 to 4508983 (24 bp); Desulfotomaculum gibsoniae DSM 7213 CGGTGGAGGTGGCGGCGGCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4505833-4509261	Sequence	Desgi_4423 - phage tail tape measure protein, TP901 family