Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 4445805
End position: 4445828
Length: 24

DNA sequence
>NC_021184, from 4445805 to 4445828 (24 bp); Desulfotomaculum gibsoniae DSM 7213 AACTTTCAACCTTTCAACCTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4445811-4446950	Sequence	Desgi_4353 - polysaccharide pyruvyl transferase CsaB (Protein is coded in complementary strand; from 4446950 to 4445811)