Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 4334890
End position: 4334913
Length: 24

DNA sequence
>NC_021184, from 4334890 to 4334913 (24 bp); Desulfotomaculum gibsoniae DSM 7213 CCGGGCCAGGGCACGGGCCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4333817-4336372	Sequence	Desgi_4251 - phosphoenolpyruvate synthase/pyruvate phosphate dikinase (Protein is coded in complementary strand; from 4336372 to 4333817)