Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 4229093
End position: 4229116
Length: 24

DNA sequence
>NC_021184, from 4229093 to 4229116 (24 bp); Desulfotomaculum gibsoniae DSM 7213 GGCCTCCGCCTCGGCCCCGGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4228485-4229276	Sequence	Desgi_4154 - alternate F1F0 ATPase, F0 subunit B (Protein is coded in complementary strand; from 4229276 to 4228485)