Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 3882904
End position: 3882927
Length: 24

DNA sequence
>NC_021184, from 3882904 to 3882927 (24 bp); Desulfotomaculum gibsoniae DSM 7213 TACTTCTTCTTCGACTTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3882806-3883345	Sequence	Desgi_3844 - Fe-S-cluster-containing hydrogenase subunit (Protein is coded in complementary strand; from 3883345 to 3882806)