Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 3628010
End position: 3628033
Length: 24

DNA sequence
>NC_021184, from 3628010 to 3628033 (24 bp); Desulfotomaculum gibsoniae DSM 7213 TACATCAACATCTATATCTACATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3627966-3628406	Sequence	Desgi_3620 - hypothetical protein (Protein is coded in complementary strand; from 3628406 to 3627966)