Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 3285337
End position: 3285360
Length: 24

DNA sequence
>NC_021184, from 3285337 to 3285360 (24 bp); Desulfotomaculum gibsoniae DSM 7213 TTCAATTTCATTATCAATTTCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3285230-3285826	Sequence	Desgi_3256 - carbonic anhydrase (Protein is coded in complementary strand; from 3285826 to 3285230)