Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 2688800
End position: 2688823
Length: 24

DNA sequence
>NC_021184, from 2688800 to 2688823 (24 bp); Desulfotomaculum gibsoniae DSM 7213 ATTAATATTAATATTCATATTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2688108-2688824	Sequence	Desgi_2654 - Tfp pilus assembly protein PilN (Protein is coded in complementary strand; from 2688824 to 2688108)