Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 2651728
End position: 2651751
Length: 24

DNA sequence
>NC_021184, from 2651728 to 2651751 (24 bp); Desulfotomaculum gibsoniae DSM 7213 CCACCAGCACCAGCACCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2651178-2651789	Sequence	Desgi_2616 - hypothetical protein (Protein is coded in complementary strand; from 2651789 to 2651178)