Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 2467225
End position: 2467248
Length: 24

DNA sequence
>NC_021184, from 2467225 to 2467248 (24 bp); Desulfotomaculum gibsoniae DSM 7213 CTTCATCTTCATCTTCATCTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2466573-2467979	Sequence	Desgi_2432 - putative S-layer protein (Protein is coded in complementary strand; from 2467979 to 2466573)