Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 2450839
End position: 2450862
Length: 24

DNA sequence
>NC_021184, from 2450839 to 2450862 (24 bp); Desulfotomaculum gibsoniae DSM 7213 TTGACTGATGGACTGATTGCCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2450558-2451637	Sequence	Desgi_2418 - hypothetical protein (Protein is coded in complementary strand; from 2451637 to 2450558)