Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 2151754
End position: 2151777
Length: 24

DNA sequence
>NC_021184, from 2151754 to 2151777 (24 bp); Desulfotomaculum gibsoniae DSM 7213 TGACGTTGAAGTTGACCTTGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2150313-2151842	Sequence	Desgi_2103 - ATPase component of uncharacterized ABC-type transporter (Protein is coded in complementary strand; from 2151842 to 2150313)