Sequence retrieval

Genome: Desulfotomaculum gibsoniae DSM 7213
Start position: 1202413
End position: 1202436
Length: 24

DNA sequence
>NC_021184, from 1202413 to 1202436 (24 bp); Desulfotomaculum gibsoniae DSM 7213 TGTTGAAAGGTTGAAAGGTTGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1201083-1202435	Sequence	Desgi_1172 - hydrogenase expression/formation protein HypD