Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 999030
End position: 999053
Length: 24

DNA sequence
>NC_021177, from 999030 to 999053 (24 bp); Streptomyces fulvissimus DSM 40593 CCGCAGCCCCAGCCGCCGCCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 998338-999228	Sequence	SFUL_868 - hypothetical protein (Protein is coded in complementary strand; from 999228 to 998338)