Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 853994
End position: 854017
Length: 24

DNA sequence
>NC_021177, from 853994 to 854017 (24 bp); Streptomyces fulvissimus DSM 40593 CGCCGACGGCGACGCCCAGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 853042-854100	Sequence	SFUL_728 - Iron ABC transporter (Protein is coded in complementary strand; from 854100 to 853042)