Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 827788
End position: 827814
Length: 27

DNA sequence
>NC_021177, from 827788 to 827814 (27 bp); Streptomyces fulvissimus DSM 40593 CCCGTGTCCGCCGTGTCCCCCGTGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 827251-827994	Sequence	SFUL_710 - Putative serine/threonine protein kinase (Protein is coded in complementary strand; from 827994 to 827251)