Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7805429
End position: 7805452
Length: 24

DNA sequence
>NC_021177, from 7805429 to 7805452 (24 bp); Streptomyces fulvissimus DSM 40593 CCACCCCCACCGGCACCCCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7805426-7807054	Sequence	SFUL_6935 - Fumarate reductase/succinate dehydrogenase flavoprotein domain protein