Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7738293
End position: 7738316
Length: 24

DNA sequence
>NC_021177, from 7738293 to 7738316 (24 bp); Streptomyces fulvissimus DSM 40593 CGCCCGCTCCCGGGCCCGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7737475-7738638	Sequence	SFUL_6867 - Glycine betaine/L-proline ABC transporter, ATPase subunit (Protein is coded in complementary strand; from 7738638 to 7737475)